CROW AUSTRALIA WEEKLY


WEEKLY DISPATCHES : 24 August, 2007

Daw, J (2007) DNA sequence from a novel infectious agent recovered from Corvus orru. CAW 7(32), 1-3.

Abstract : An unusual DNA sequence has been extracted from an infectious agent recovered from Corvus orru (Torresian Crows) exhibiting signs of neurological disturbance. While identification of the infectious agent has been made difficult through lack of suitable specimens and the extreme variability between organims recovered from different specimens, a small sequence of DNA appears to be conserved in all samples. The sequence reads :

TACTTGATAGTACCGTGGTATGGTACCCGTAATACCTGGATT


© 2007 Dr Peter Darben