Daw, J (2007) DNA sequence from a novel infectious agent recovered from
Corvus orru.
CAW 7(32), 1-3.
Abstract : An unusual DNA sequence has been extracted from an
infectious agent recovered from
Corvus orru (Torresian Crows) exhibiting
signs of neurological disturbance. While identification of the infectious
agent has been made difficult through lack of suitable specimens and the
extreme variability between organims recovered from different specimens,
a small sequence of DNA appears to be conserved in all samples. The sequence
reads :
TACTTGATAGTACCGTGGTATGGTACCCGTAATACCTGGATT