Outbreak Lesson #4

This lesson will involve you accessing some online tutorials in DNA structure and protein synthesis. You will have to study the tutorial, produce a description of the process of protein synthesis, and use the tutorial to translate a DNA sequence into a stretch of protein.

Check out the recent articles in the Curious Snail

Go to Interactive Concepts in Biology and click on the Protein Synthesis link. Watch the interactive tutorial and perform the "test yourself"

Using the tutorial, write a brief description of the process of Protein Synthesis. Try to write the description so that it could be understood by someone without any experience in science

You have received the DNA sequence which has been recovered from the tissues of the afflicted crows. It reads

      TACTTGATAGTACCGTGGTATGGTACCCGTAATACCTGGATT

       Transcribe this to RNA (remember : T becomes A, A becomes U, G becomes C and C becomes G) and
            then use the table to derive an amino acid sequence. Compare this to the amino acid sequence of the
            peptide fragment recovered from the crow's brains

This last activity may be used in your Outbreak assignment when you try to hunt down the identity of the disease agent